After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain NRAS / N-Ras expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NRAS Informations sur les produits clonés de cDNA
Taille du ADNc:570bp
Description du ADNc:Full length Clone DNA of Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog with C terminal HA tag.
Synonyme du gène:NS6, ALPS4, N-ras, NRAS1, NRAS
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.
  • Size / Price
    Catalogue : HG12073-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.