Nuf2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

Nuf2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Human NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nuf2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CDCA1 cDNA ORF Clone, Human; CT106 cDNA ORF Clone, Human; NUF2R cDNA ORF Clone, Human

Nuf2 Background Information

NUF2 (NUF2, Ndc8 kinetochore complex component), which is essential for kinetochore-microtubule attachment in mitosis, has emerged as a critical mediator of the cell cycle in multiple tumour occurrences.It has been reported that NUF2 is associated with multiple human cancers.NUF2 is consistently overexpressed in human PC and NUF2 is closely linked with human PC progression through the meditator LncRNA AF339813.As an important component of the NDC8 kinetochore complex, NUF2 is essential for kinetochore-microtubule attachment and chromosome segregation.
Full Name
NUF2, NDC80 kinetochore complex component
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait