After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human OAT Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000274.3
Taille du ADNc:1320bp
Description du ADNc:Full length Clone DNA of Homo sapiens ornithine aminotransferase.
Synonyme du gène:OKT, GACR, HOGA, OATASE
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG16152-ACGCHF270
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG16152-ACRCHF270
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG16152-ANGCHF270
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG16152-ANRCHF270
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG16152-CFCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG16152-CHCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG16152-CMCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG16152-CYCHF230
Humain OAT/ornithine aminotransferase Gène ADNc clone le vecteur de clonageHG16152-GCHF90
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG16152-NFCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG16152-NHCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG16152-NMCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG16152-NYCHF230
Humain OAT/ornithine aminotransferase expression plasmide de Gène l'ADNc ORF cloneHG16152-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG16152-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »