Commande rapide

Text Size:AAA

Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain OLAH Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC050372
Taille du ADNc:798bp
Description du ADNc:Full length Clone DNA of Homo sapiens oleoyl-ACP hydrolase with C terminal His tag.
Synonyme du gène:SAST, AURA1, THEDC1
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with OLAH qPCR primers for gene expression analysis, HP103789 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15162-ACGCHF270
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15162-ACRCHF270
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15162-ANGCHF270
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15162-ANRCHF270
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15162-CFCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15162-CHCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15162-CMCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15162-CYCHF230
Humain OLAH/oleoyl-ACP hydrolase Gène ADNc clone le vecteur de clonageHG15162-GCHF90
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15162-NFCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15162-NHCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15162-NMCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15162-NYCHF230
Humain OLAH/oleoyl-ACP hydrolase expression plasmide de Gène l'ADNc ORF cloneHG15162-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »