Commande rapide

Humain P2RX1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain P2RX1 Informations sur les produits clonés de cDNA
    Taille du ADNc:1200bp
    Description du ADNc:Full length Clone DNA of Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 with C terminal His tag.
    Synonyme du gène:P2X1
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    ( We provide with P2RX1 qPCR primers for gene expression analysis, HP103802 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.