PACSIN1 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

PACSIN1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Human protein kinase C and casein kinase substrate in neurons 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PACSIN1 cDNA ORF Clone, Human, C-His tag: Alternative Names

SDPI cDNA ORF Clone, Human

PACSIN1 Background Information

PACSIN1 is an important Tau binding partner in regulating microtubule dynamics and forming axonal plasticity.PACSIN1 interacts with Tau in axon. PACSIN1 blockade results in impaired axonal elongation and a higher number of primary axonal branches in mouse dorsal root ganglia neurons, which is induced by increasing the binding ability of Tau to microtubules.In PACSIN1-blocked dorsal root ganglia neurons, a greater amount of Tau is inclined to accumulate in the central domain of growth cones, and it promotes the stability of the microtubule network.
Full Name
protein kinase C and casein kinase substrate in neurons 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait