PAH cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

PAH cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1359 bp
Description
Full length Clone DNA of Human phenylalanine hydroxylase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PAH cDNA ORF Clone, Human, N-Myc tag: Alternative Names

PH cDNA ORF Clone, Human; PKU cDNA ORF Clone, Human; PKU1 cDNA ORF Clone, Human

PAH Background Information

PAH (phenylalanine hydroxylase), also known as PH, belongs to the biopterin-dependent aromatic amino acid hydroxylase family. It contains 1 ACT domain, N-terminal region of PAH is thought to contain allosteric binding sites for phenylalanine and to constitute an "inhibitory" domain that regulates the activity of a catalytic domain in the C-terminal portion of the molecule. In humans, PAH is expressed both in the liver and the kidney, and there is some indication that it may be differentially regulated in these tissues. PAH catalyzes the hydroxylation of the aromatic side-chain of phenylalanine to generate tyrosine. It is one of three members of the pterin-dependent amino acid hydroxylases, a class of monooxygenase that uses tetrahydrobiopterin and a non-heme iron for catalysis. Defects in PAH are the cause of phenylketonuria (PKU). PKU is an autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 12 mumol.
Full Name
phenylalanine hydroxylase
References
  • Fitzpatrick PF, et al. (1999) Tetrahydropterin-dependent amino acid hydroxylases. Annu Rev Biochem. 68:355-81.
  • Olsson E, et al. (2011) Formation of the iron-oxo hydroxylating species in the catalytic cycle of aromatic amino acid hydroxylases. Chemistry. 17(13):3746-58.
  • Bassan A, et al. (2003) Mechanism of aromatic hydroxylation by an activated FeIVO core in tetrahydrobiopterin-dependent hydroxylases. Chemistry. 9(17):4055-67.
  • Panay AJ, et al. (2011) Evidence for a high-spin Fe(IV) species in the catalytic cycle of a bacterial phenylalanine hydroxylase. Biochemistry. 50(11):1928-33.
  • Bassan A, et al. (2003) Mechanism of dioxygen cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases. Chemistry. 9(1):106-15.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait