PAK6 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

PAK6 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2091 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 6 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.09kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PAK6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAK6 cDNA ORF Clone, Human, C-His tag: Validated Images

PAK6 cDNA ORF Clone, Human, C-His tag: Alternative Names

PAK5 cDNA ORF Clone, Human

PAK6 Background Information

P21-activated kinase 6 (PAK6) is a serine/threonine kinase belonging to the p21-activated kinase (PAK) family. PAK6 was a 75-kDa protein with a predicted N-terminal Cdc42/Rac interactive binding domain and a C-terminal kinase domain. PAK6 bound strongly to GTP-Cdc42 and weakly to GTP-Rac.PAK6 is a member of the p21-activated kinase (PAK) family of serine/threonine kinases that was originally cloned from prostate cancer (PCa) cells as an androgen receptor interacting proteinP-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer.PAK6, a type II PAK, influences behavior and locomotor function in mice and has an ascribed role in androgen receptor signaling.
Full Name
p21 protein (Cdc42/Rac)-activated kinase 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait