PAM cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PAM cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2601 bp
Description
Full length Clone DNA of Human peptidylglycine alpha-amidating monooxygenase.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PAM cDNA ORF Clone, Human, untagged: Alternative Names

PAL cDNA ORF Clone, Human; PHM cDNA ORF Clone, Human

PAM Background Information

Peptidylglycine alpha-amidating monooxygenase (PAM) is highly expressed in neurons and endocrine cells, where it catalyzes one of the final steps in the biosynthesis of bioactive peptides. PAM is also expressed in unicellular organisms such as Chlamydomonas reinhardtii, which do not store peptides in secretory granules. As for other granule membrane proteins, PAM is retrieved from the cell surface and returned to the trans-Golgi network. This pathway involves regulated entry of PAM into multivesicular body intralumenal vesicles (ILVs).Peptidylglycine alpha-amidating monooxygenase (PAM) is an essential enzyme that catalyzes the COOH-terminal amidation of many neuroendocrine peptides.
Full Name
peptidylglycine alpha-amidating monooxygenase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait