After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PARP3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005485.4
Taille du ADNc:1602bp
Description du ADNc:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Synonyme du gène:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PARP3
Site de restriction:KpnI + XbaI (6.1kb + 1.6kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11190-ACGCHF290
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11190-ACRCHF290
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11190-ANGCHF290
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11190-ANRCHF290
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11190-CFCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11190-CHCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11190-CMCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11190-CYCHF260
Humain PARP3 transcript variant 2 Gène ADNc clone le vecteur de clonageHG11190-MCHF90
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11190-M-FCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11190-NFCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11190-NHCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11190-NMCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11190-NYCHF260
Humain PARP3 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG11190-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Références
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Catalogue : HG11190-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »