Commande rapide

Humain Actopaxin expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain PARVA Informations sur les produits clonés de cDNA
    Taille du ADNc:1119bp
    Description du ADNc:Full length Clone DNA of Homo sapiens parvin, alpha with C terminal Flag tag.
    Synonyme du gène:MXRA2, CH-ILKBP
    Site de restriction:
    Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Description de la séquence:
    ( We provide with PARVA qPCR primers for gene expression analysis, HP102583 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name

    Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Catalogue : HG13919-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.