After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PDCD4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_014456.3
Taille du ADNc:1410 bp
Description du ADNc:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
Synonyme du gène:H731
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PDCD4
Site de restriction:KpnI + XbaI(6.1kb+1.41kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11193-ACGCHF270
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11193-ACRCHF270
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11193-ANGCHF270
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11193-ANRCHF270
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11193-CFCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11193-CHCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11193-CMCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11193-CYCHF230
Humain PDCD4 transcript variant 1 Gène ADNc clone le vecteur de clonageHG11193-MCHF90
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11193-NFCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11193-NHCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11193-NMCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11193-NYCHF230
Humain PDCD4 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11193-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11193-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »