PDE6B cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PDE6B cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2562 bp
Description
Full length Clone DNA of Human phosphodiesterase 6B, cGMP-specific, rod, beta.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDE6B cDNA ORF Clone, Human, untagged: Alternative Names

CSNB3 cDNA ORF Clone, Human; CSNBAD2 cDNA ORF Clone, Human; PDEB cDNA ORF Clone, Human; rd1 cDNA ORF Clone, Human; RP40 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait