After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PDGFB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002608.2
Taille du ADNc:726bp
Description du ADNc:Full length Clone DNA of Homo sapiens platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) with N terminal Flag tag.
Synonyme du gène:SIS, SSV, PDGF2, c-sis, FLJ12858
Espèces:Human
Vecteur:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-PDGFB
Site de restriction:KpnI + XbaI (6kb + 0.75kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PDGFB Gene Plasmid Map
Human PDGF-B natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10572-ACGCHF270
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10572-ACRCHF270
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10572-CFCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10572-CHCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10572-CMCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10572-CYCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10572-MCHF90
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10572-M-HCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10572-NFCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10572-NHCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10572-NMCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10572-NYCHF230
Humain PDGF-B/PDGF-2 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10572-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10572-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Human PDGF-B natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »