Commande rapide

Humain PFK1/PFKM expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain PFKM Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC021203
Taille du ADNc:2388 bp
Description du ADNc:Full length Clone DNA of Homo sapiens phosphofructokinase, muscle with C terminal Myc tag.
Synonyme du gène:GSD7, MGC8699, PFK-1, PFK1, PFKA, PFKX, PFKM
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:pCMV3-PFKM-Myc
Site de restriction:KpnI + XbaI(pCMV3-C-Myc-KpnI-XbaI)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PFKM qPCR primers for gene expression analysis, HP102786 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Catalogue : HG14133-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »