After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PGM3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC001258
Taille du ADNc:1629bp
Description du ADNc:Full length Clone DNA of Homo sapiens phosphoglucomutase 3 with N terminal His tag.
Synonyme du gène:AGM1, PAGM, PGM 3
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14852-ACGCHF290
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14852-ACRCHF290
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14852-ANGCHF290
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14852-ANRCHF290
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14852-CFCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14852-CHCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14852-CMCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14852-CYCHF260
Humain PGM3/phosphoglucomutase 3 Gène ADNc clone le vecteur de clonageHG14852-GCHF90
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14852-NFCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14852-NHCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14852-NMCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14852-NYCHF260
Humain PGM3/phosphoglucomutase 3 expression plasmide de Gène l'ADNc ORF cloneHG14852-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG14852-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »