After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PI3/Elafin/WFDC14 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PI3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC010952
Taille du ADNc:354bp
Description du ADNc:Full length Clone DNA of Homo sapiens peptidase inhibitor 3, skin-derived with C terminal Myc tag.
Synonyme du gène:ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.

Size / Price
Catalogue : HG12187-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »