PIWIL4 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PIWIL4 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2559 bp
Description
Full length Clone DNA of Human piwi-like 4 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PIWIL4 cDNA ORF Clone, Human, untagged: Alternative Names

HIWI2 cDNA ORF Clone, Human; MIWI2 cDNA ORF Clone, Human

PIWIL4 Background Information

PIWIL4 has been identified as a functional protein involved in tumorigenesis.PIWIL4 was identified as a target of miR-384 and plays an oncogenic role in glioma.One of the four PIWI proteins in humans, PIWIL4, is highly expressed in both breast cancer tissues and the cytoplasm of MDA-MB-231 cells derived from breast cancer. Reducing PIWIL4 expression drastically impairs the migration ability of MDA-MB-231 cells, significantly increases their apoptosis, and mildly affects their proliferation. PIWIL4 plays important roles in the chromatin-modifying pathway in human somatic cells.
Full Name
piwi-like RNA-mediated gene silencing 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait