After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PLBD2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PLBD2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_173542.3
Taille du ADNc:1770bp
Description du ADNc:Full length Clone DNA of Homo sapiens phospholipase B domain containing 2 with C terminal Flag tag.
Synonyme du gène:P76
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

PLBD2 localizes to the lysosome, as its absence could plausibly lead to a serious yet unrecognized lysosomal storage disease. PLBD1 and PLBD2 are semi-orphans in the sense of being probable phospholipases of B class but with uncertain physiological substrates and thus functionalities. PLBD1 and PLBD2 constitute a small gene family (sequence homology class) within vertebrates though one that occurs expanded in some early diverging eukaryotes. PLBD2 presents a special difficulty in that a sequence of post-translational steps are apparently necessary for its activation. Without these, potential substrates can hardly be assayed. These steps include removal of the signal peptide, mannosylation appropriate to the lysosome targeting receptor, and self-catalytic proteolytic activation to expose the substrate binding site as this becomes appropriate.

Références
  • Morgan CP. et al., 2004), Biochem J. 382 (2): 441-9.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012. Cell. 150 (5): 1068-81.
  • Size / Price
    Catalogue : HG13947-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »