ADFP / PLIN2 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

ADFP / PLIN2 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Human perilipin 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ADFP / PLIN2 cDNA ORF Clone, Human, C-His tag: Alternative Names

ADFP cDNA ORF Clone, Human; ADRP cDNA ORF Clone, Human

ADFP / PLIN2 Background Information

PLIN2 (Perilipin-2) is a protein that can anchor on the membrane of lipid droplets (LDs), playing a vital role in the early formation of LDs and in the regulation of LD metabolism in many types of cells.Perilipin 2 (PLIN2) is the most abundant lipid droplet (LD)-associated protein in nonadipose tissue, and its expression correlates with intracellular lipid accumulation.PLIN2 (perilipin 2) is a cytosolic protein that promotes the formation and stabilization of the intracellular lipid droplets, organelles involved in the storage of lipid depots.
Full Name
perilipin 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait