SILV cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

SILV cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1986 bp
Description
Full length Clone DNA of Human premelanosome protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About SILV

Entrez Gene ID

SILV cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

D12S53E cDNA ORF Clone, Human; gp100 cDNA ORF Clone, Human; ME20 cDNA ORF Clone, Human; ME20-M cDNA ORF Clone, Human; ME20M cDNA ORF Clone, Human; P1 cDNA ORF Clone, Human; P100 cDNA ORF Clone, Human; PMEL17 cDNA ORF Clone, Human; SI cDNA ORF Clone, Human; SIL cDNA ORF Clone, Human; SILV cDNA ORF Clone, Human

SILV Background Information

SILV gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants.
Full Name
premelanosome protein
References
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait