Commande rapide

Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PMM2 Informations sur les produits clonés de cDNA
Taille du ADNc:741bp
Description du ADNc:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
Synonyme du gène:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14648-ACGCHF270
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14648-ACRCHF270
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14648-ANGCHF270
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14648-ANRCHF270
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14648-CFCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14648-CHCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14648-CMCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14648-CYCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 Gène ADNc clone le vecteur de clonageHG14648-GCHF90
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14648-NFCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14648-NHCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14648-NMCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14648-NYCHF230
Humain phosphomannomutase 2 / PMM2 / CDG1 expression plasmide de Gène l'ADNc ORF cloneHG14648-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.