After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PMVK Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC006089
Taille du ADNc:579bp
Description du ADNc:Full length Clone DNA of Homo sapiens phosphomevalonate kinase with N terminal Flag tag.
Synonyme du gène:PMK, PMKA, PMKASE, HUMPMKI
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14583-ACGCHF270
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14583-ACRCHF270
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14583-ANGCHF270
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14583-ANRCHF270
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14583-CFCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14583-CHCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14583-CMCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14583-CYCHF230
Humain PMVK / phosphomevalonate kinase Gène ADNc clone le vecteur de clonageHG14583-GCHF90
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14583-NFCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14583-NHCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14583-NMCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14583-NYCHF230
Humain PMVK / phosphomevalonate kinase expression plasmide de Gène l'ADNc ORF cloneHG14583-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

PMVK is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of PMVK is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis.

Size / Price
Catalogue : HG14583-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »