PPARA cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

PPARA cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Human peroxisome proliferator-activated receptor alpha with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PPARA cDNA ORF Clone, Human, N-Myc tag: Alternative Names

hPPAR cDNA ORF Clone, Human; NR1C1 cDNA ORF Clone, Human; PPAR cDNA ORF Clone, Human; PPARalpha cDNA ORF Clone, Human

PPARA Background Information

Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined.
Full Name
peroxisome proliferator-activated receptor alpha
References
  • Janssen AWF, Betzel B, Stoopen G, et al. The impact of PPARα activation on whole genome gene expression in human precision cut liver slices. BMC Genomics. 2015;16:760.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait