PPIE cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PPIE cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Human peptidylprolyl isomerase E (cyclophilin E).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PPIE cDNA ORF Clone, Human, untagged: Alternative Names

CYP-33 cDNA ORF Clone, Human; CYP33 cDNA ORF Clone, Human

PPIE Background Information

This gene, tentatively named PPIE (peptidyl-prolyl cis-trans isomerase E), has 83% amino acid identity with the central conserved region of cyclophilin A, is evolutionarily conserved by Southern blot, and exhibits differential tissue expression with highest levels found in muscle and brain.The prognostic and functional consequences of PPIE gene amplification in SCLC can now be determined.
Full Name
peptidylprolyl isomerase E (cyclophilin E)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait