Commande rapide

Text Size:AAA

Human PPM1G ORF mammalian expression plasmid, N-Flag tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PPM1G Informations sur les produits clonés de cDNA
Taille du ADNc:1641bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent, 1G with N terminal Flag tag.
Synonyme du gène:PP2CG, PPP2CG, MGC1675, MGC2870, PP2CGAMMA, PPM1G
Site de restriction:KpnI + XbaI (6kb + 1.69kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PPM1G Gene Plasmid Map
Human PPM1G natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Protein phosphatase 1G, also known as Protein phosphatase 1C, Protein phosphatase 2C isoform gamma, Protein phosphatase magnesium-dependent 1 gamma, PP2C-gamma, PPM1G and PPM1C, is a cytoplasm protein which belongs to the PP2C family. PPM1G / PP2C-gamma is widely expressed. It is most abundant in testis, skeletal muscle, and heart. Alternatively spliced transcript variants encoding the same protein have been described. PP2C family members are known to be negative regulators of cell stress response pathways.  PPM1G / PP2C-gamma is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. PPM1G / PP2C-gamma also plays a role in regulating cell cycle progression.

  • Travis S.M., et al., 1997, FEBS Lett. 412:415-9.
  • Molina H., et al., 2007, Proc. Natl. Acad. Sci. USA. 104: 2199-204.
  • Matsuoka S., et al., 2007, Science 316:1160-6.
  • Size / Price
    Catalogue : HG11245-NF
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
    • Human PPM1G natural ORF mammalian expression plasmid, N-Flag tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.