Commande rapide

Text Size:AAA

Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PPP3CA Informations sur les produits clonés de cDNA
Taille du ADNc:1566bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1 with N terminal His tag.
Synonyme du gène:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13670-ACGCHF290
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13670-ACRCHF290
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13670-ANGCHF290
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13670-ANRCHF290
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13670-CFCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13670-CHCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13670-CMCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13670-CYCHF260
Humain PPP3CA transcript variant 1 Gène ADNc clone le vecteur de clonageHG13670-GCHF90
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13670-NFCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13670-NHCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13670-NMCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13670-NYCHF260
Humain PPP3CA transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG13670-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.