After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PRC1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PRC1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC003138
Taille du ADNc:1863bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein regulator of cytokinesis 1.
Synonyme du gène:ASE1, PRC1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis. It interacts with KIF14, IF20A and PLK1.

Références
  • Jiang W, et al. (1999) PRC1: a human mitotic spindle-associated CDK substrate protein required for cytokinesis. Mol Cell. 2(6):877-85.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):173-8.
  • Mollinari C, et al. (2002) PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol. 15 (7):1175-86.
  • Size / Price
    Catalogue : HG13280-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »