After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PRDX1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC007063.1
Taille du ADNc:600bp
Description du ADNc:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
Synonyme du gène:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PRDX1
Site de restriction:KpnI + XbaI (6.1kb + 0.6kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11194-ACGCHF270
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11194-ACRCHF270
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11194-ANGCHF270
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11194-ANRCHF270
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11194-CFCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11194-CHCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11194-CMCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11194-CYCHF230
Humain Peroxiredoxin 1/PRDX1 Gène ADNc clone le vecteur de clonageHG11194-MCHF90
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11194-M-FCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11194-NFCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11194-NHCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11194-NMCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11194-NYCHF230
Humain Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF cloneHG11194-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Références
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catalogue : HG11194-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »