After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PREP Informations sur les produits clonés de cDNA
Taille du ADNc:2133bp
Description du ADNc:Full length Clone DNA of Homo sapiens prolyl endopeptidase with C terminal Flag tag.
Synonyme du gène:PE, PEP, MGC16060
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10987-ACGCHF290
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10987-ACRCHF290
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10987-ANGCHF290
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10987-ANRCHF290
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10987-CFCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10987-CHCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10987-CMCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10987-CYCHF260
Humain Prolyl endopeptidase / PREP Gène ADNc clone le vecteur de clonageHG10987-MCHF90
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10987-NFCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10987-NHCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10987-NMCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10987-NYCHF260
Humain Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF cloneHG10987-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Catalogue : HG10987-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.