Commande rapide

Humain PRKAB2 expression plasmide de Gène l'ADNc ORF clone

  • Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain PRKAB2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005399
Taille du ADNc:819bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein kinase, AMP-activated, beta 2 non-catalytic subunit.
Synonyme du gène:MGC61468, PRKAB2
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PRKAB2
Site de restriction:KpnI + XbaI (6.1kb + 0.82kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PRKAB2 qPCR primers for gene expression analysis, HP101568 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain PRKAB2 Gene Plasmid Map
Human PRKAB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalogue : HG12032-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »