Prolactin cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/2
Price:
Size:
Number:

Prolactin cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
684 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prolactin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 0.69kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Prolactin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prolactin cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Prolactin Background Information

Prolactin (PRL) is a hormone with multiple actions in the central nervous system (CNS) spanning from physiology to pathology. PRL exerts different actions through its receptors that can be found in both neurons and glial cells (astrocytes, microglia and oligodendrocytes) of the brain.It is generally believed that in vertebrates, prolactin (PRL) is predominantly synthesized and released by pituitary lactotrophs and plays important roles in many physiological processes via activation of PRL receptor (PRLR), including water and electrolyte balance, reproduction, growth and development, metabolism, immuno-modulation, and behavior.
Full Name
prolactin
References
  • Jara LJ, et al. (2011) Prolactin and autoimmunity. Clin Rev Allergy Immunol. 40(1): 50-9.
  • Urban A, et al. (2007) Prolactin as a factor for increased platelet aggregation. Neuro Endocrinol Lett. 28(4): 518-23.
  • Charoenphandhu N, et al. (2007) Prolactin is an important regulator of intestinal calcium transport. Can J Physiol Pharmacol. 85(6): 569-81.
  • Tworoger SS, et al. (2006) Prolactin and breast cancer risk. Cancer Lett. 243(2): 160-9.
  • Ben-Jonathan N, et al. (2006) Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab. 17(3): 110-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait