Commande rapide

Humain PSMB8 expression plasmide de Gène l'ADNc ORF clone

  • Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain PSMB8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_004159.4
Taille du ADNc:819bp
Description du ADNc:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7).
Synonyme du gène:LMP7, D6S216, PSMB5i, RING10, D6S216E, MGC1491, PSMB8
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PSMB8
Site de restriction:KpnI + XbaI (6.1kb + 0.82kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PSMB8 qPCR primers for gene expression analysis, HP101564 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain PSMB8 Gene Plasmid Map
Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalogue : HG12028-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »