After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PSME2 / PA28b expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PSME2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC004368
Taille du ADNc:720bp
Description du ADNc:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 2 (PA28 beta) with N terminal HA tag.
Synonyme du gène:PA28B, REGbeta, PA28beta
Espèces:Human
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain PSME2 / PA28b expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Product nameProduct name
Fond

PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

Références
  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • Size / Price
    Catalogue : HG14640-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »