Commande rapide

Humain COX-2/PTGS2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PTGS2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000963
Taille du ADNc:1815bp
Description du ADNc:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase).
Synonyme du gène:COX2
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-PTGS2
Site de restriction:HindIII + XbaI (6.1kb + 1.82kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Fond

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

Références
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Catalogue : HG12036-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human PTGS2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »