PTP4A2 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

PTP4A2 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human protein tyrosine phosphatase type IVA, member 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PTP4A2 cDNA ORF Clone, Human, C-His tag: Alternative Names

HH13 cDNA ORF Clone, Human; HH7-2 cDNA ORF Clone, Human; HMT cDNA ORF Clone, Human; HNMT-S1 cDNA ORF Clone, Human; HNMT-S2 cDNA ORF Clone, Human; HU-PP-1 cDNA ORF Clone, Human; OV-1 cDNA ORF Clone, Human; PRL-2 cDNA ORF Clone, Human; PRL2 cDNA ORF Clone, Human; ptp-IV1a cDNA ORF Clone, Human; ptp-IV1b cDNA ORF Clone, Human; PTP4A cDNA ORF Clone, Human; PTPCAAX2 cDNA ORF Clone, Human

PTP4A2 Background Information

PRL-2 (Protein-tyrosine phosphatase of regenerating liver 2), also known as PTP4A2 (Protein tyrosine phosphatase type IVA, member 2), is a member of PTP family and has an important function in controlling cell growth. PRL-2 phosphatases may be multifunctional enzymes with diverse roles in a variety of tissue and cell types. The phosphatase of regenerating liver (PRL) family, comprising PRL-1, PRL-2 and PRL-3, is a group of prenylated phosphatases that are candidate cancer biomarkers and therapeutic targets. PRL-1, PRL-2, and PRL-3 represent a novel class of protein-tyrosine phosphatase with a C-terminal prenylation motif. They are three closely related intracellular enzymes that possess the PTP active site signature sequence CX 5R. The PRL-2 mRNA is elevated in primary breast tumors relative to matched normal tissue, and also dramatically elevated in metastatic lymph nodes compared with primary tumors. PRL-2 plays a role in breast cancer progression. PRL-2 is a pathogenic molecule in hematopoietic malignancies and suggest its potential as a novel therapeutic target.
Full Name
protein tyrosine phosphatase type IVA, member 2
References
  • Akiyama S, et al. (2010) PRL-2 increases Epo and IL-3 responses in hematopoietic cells. Blood Cells Mol Dis. 44(4): 209-14.
  • Hardy S, et al. (2010) Overexpression of the protein tyrosine phosphatase PRL-2 correlates with breast tumor formation and progression. Cancer Res. 70(21): 8959-67.
  • Yuan L, et al. (2007) Differential expression and functional constraint of PRL-2 in hibernating bat. Comp Biochem Physiol B Biochem Mol Biol. 148(4): 375-81.
  • Dumaual CM, et al. (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues. J Histochem Cytochem. 54(12): 1401-12.
  • Zeng Q, et al. (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome. J Biol Chem. 275(28): 21444-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait