SHP2 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

SHP2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1383 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 11.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.38kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SHP2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHP2 cDNA ORF Clone, Human, untagged: Validated Images

SHP2 cDNA ORF Clone, Human, untagged: Alternative Names

BPTP3 cDNA ORF Clone, Human; CFC cDNA ORF Clone, Human; NS1 cDNA ORF Clone, Human; PTP-1D cDNA ORF Clone, Human; PTP2C cDNA ORF Clone, Human; SH-PTP2 cDNA ORF Clone, Human; SH-PTP3 cDNA ORF Clone, Human; SHP2 cDNA ORF Clone, Human

SHP2 Background Information

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.
Full Name
protein tyrosine phosphatase, non-receptor type 11
References
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait