After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PTPN2 Informations sur les produits clonés de cDNA
Taille du ADNc:1248bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 with N terminal Flag tag.
Synonyme du gène:PTPT, TCPTP, TC-PTP, TCELLPTP
Site de restriction:KpnI + NotI (6kb + 1.29kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTPN2 Gene Plasmid Map
Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10570-ACGCHF270
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10570-ACRCHF270
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10570-ANGCHF270
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10570-ANRCHF270
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10570-CFCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10570-CHCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10570-CMCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10570-CYCHF234
Humain PTPN2/TC-PTP transcript variant 1 Gène ADNc clone le vecteur de clonageHG10570-MCHF90
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10570-NFCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10570-NHCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10570-NMCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10570-NYCHF234
Humain PTPN2/TC-PTP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10570-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Size / Price
Catalogue : HG10570-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
  • Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.