Prostasin cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Prostasin cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protease, serine, 8.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.03kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Prostasin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prostasin cDNA ORF Clone, Human, untagged: Validated Images

Prostasin cDNA ORF Clone, Human, untagged: Alternative Names

CAP1 cDNA ORF Clone, Human; PROSTASIN cDNA ORF Clone, Human

Prostasin Background Information

Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.
Full Name
protease, serine, 8
References
  • Yu J.X., et al.,(1995), Molecular cloning, tissue-specific expression, and cellular localization of human prostasin mRNA. J. Biol. Chem. 270:13483-13489.
  • Ota T., et al., (2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Martin J., et al.,(2004), The sequence and analysis of duplication-rich human chromosome 16.Nature 432:988-994.

Prostasin cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait