After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Human RAB5A ORF mammalian expression plasmid, C-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RAB5A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC001267
Taille du ADNc:648bp
Description du ADNc:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Synonyme du gène:RAB5, RAB5A
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Site de restriction:KpnI + XbaI (6kb + 0.69kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalogue : HG14013-CH
Prix catalogue :   (Save )
Prix :      [How to order]
Disponibilité
 Instructions d’expédition
Images
  • Human RAB5A ORF mammalian expression plasmid, C-His tag
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »