Commande rapide

Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RELA Informations sur les produits clonés de cDNA
Taille du ADNc:1656bp
Description du ADNc:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Synonyme du gène:p65
Site de restriction:KpnI + XbaI (6kb + 1.7kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12054-ACGCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12054-ACRCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12054-ANGCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12054-ANRCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12054-CFCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12054-CHCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12054-CMCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12054-CYCHF260
Humain RELA / Transcription factor p65 Gène ADNc clone le vecteur de clonageHG12054-GCHF90
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12054-NFCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12054-NHCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12054-NMCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12054-NYCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF cloneHG12054-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catalogue : HG12054-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.