After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RELA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_021975
Taille du ADNc:1656bp
Description du ADNc:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Synonyme du gène:p65
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:pCMV3-RELA-His
Site de restriction:KpnI + XbaI (6kb + 1.7kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12054-ACGCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12054-ACRCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12054-ANGCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12054-ANRCHF290
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12054-CFCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12054-CHCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12054-CMCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12054-CYCHF260
Humain RELA / Transcription factor p65 Gène ADNc clone le vecteur de clonageHG12054-GCHF90
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12054-NFCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12054-NHCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12054-NMCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12054-NYCHF260
Humain RELA / Transcription factor p65 expression plasmide de Gène l'ADNc ORF cloneHG12054-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

Références
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catalogue : HG12054-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »