Renin cDNA ORF Clone, Human, C-HA tag

Cat: HG10969-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Renin Reagents

CRO Services

Product recommended


All Renin Reagents

Renin cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Human rennin with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Renin cDNA ORF Clone, Human, C-HA tag Alternative Names

FLJ10761 cDNA ORF Clone, Human;HNFJ2 cDNA ORF Clone, Human;REN cDNA ORF Clone, Human

Renin Background Information

Renin-1, also known as Ren-1, Angiotensinogenase and Kidney renin, is a member of the peptidase A1 family. Renin-1 is synthesized by the juxtaglomerular cells of the kidney in response to decreased blood pressure and sodium concentration. androgen and thyroid hormones influence levels of Renin-1 in mouse submandibular gland (SMG) primarily by regulating the amount of Renin-1 mRNA available for translation. Renin-1 is a highly specific endopeptidase, whose only known function is to generate angiotensin I from angiotensinogen in the plasma, initiating a cascade of reactions that produce an elevation of blood pressure and increased sodium retention by the kidney. It is expressed at relatively low levels in mouse SMG and kidney. Ren-2 is expressed at high levels in the mouse SMG and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression.
Full Name
renin
References
  • McKeon F.D., et al.,(1986), Homologies in both primary and secondary structure between nuclear envelope and intermediate filament proteins. Nature 319:463-468.
  • Fisher D.Z., et al., (1986), cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins.Proc. Natl. Acad. Sci. U.S.A. 83:6450-6454.
  • Sylvius N., et al.,(2005), In vivo and in vitro examination of the functional significances of novel lamin gene mutations in heart failure patients.J. Med. Genet. 42:639-647.
  • Renin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Renin cDNA ORF Clone in Cloning Vector, Mouse MG50279-M
    Renin cDNA ORF Clone, Mouse, untagged MG50279-UT
    Renin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50279-ACG
    Renin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50279-ACGLN
    Renin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50279-ACR
    Renin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50279-CF
    Renin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50279-NF
    Renin cDNA ORF Clone, Mouse, C-His tag MG50279-CH
    Renin cDNA ORF Clone, Mouse, N-His tag MG50279-NH
    Renin cDNA ORF Clone, Mouse, C-HA tag MG50279-CY
    Renin cDNA ORF Clone, Mouse, N-HA tag MG50279-NY
    Renin cDNA ORF Clone, Mouse, C-Myc tag MG50279-CM
    Renin cDNA ORF Clone, Mouse, N-Myc tag MG50279-NM
    Renin qPCR Primer Pairs, Mouse MP200303

    Renin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Renin cDNA ORF Clone in Cloning Vector, Human HG10969-M
    Renin cDNA ORF Clone, Human, untagged HG10969-UT
    Renin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10969-ACGLN
    Renin cDNA ORF Clone, Human, C-GFPSpark® tag HG10969-ACG
    Renin cDNA ORF Clone, Human, C-OFPSpark® tag HG10969-ACR
    Renin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10969-CF
    Renin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10969-NF
    Renin cDNA ORF Clone, Human, C-His tag HG10969-CH
    Renin cDNA ORF Clone, Human, N-His tag HG10969-NH
    Renin cDNA ORF Clone, Human, N-HA tag HG10969-NY
    Renin cDNA ORF Clone, Human, C-Myc tag HG10969-CM
    Renin cDNA ORF Clone, Human, N-Myc tag HG10969-NM
    Renin qPCR Primer Pairs, Human HP100053
    info info
    添加购物车成功! 添加购物车失败!