Commande rapide

Humain RGMA expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RGMA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_020211
Taille du ADNc:1227bp
Description du ADNc:Full length Clone DNA of Homo sapiens RGM domain family, member A with N terminal Flag tag.
Synonyme du gène:RGM
Espèces:Human
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

Références
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Catalogue : HG12086-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »