After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RGS5 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC030059
Taille du ADNc:546bp
Description du ADNc:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
Synonyme du gène:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15234-ACGCHF270
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15234-ACRCHF270
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15234-ANGCHF270
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15234-ANRCHF270
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15234-CFCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15234-CHCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15234-CMCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15234-CYCHF230
Humain RGS5 / Regulator of G-protein signaling 5 Gène ADNc clone le vecteur de clonageHG15234-GCHF90
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15234-NFCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15234-NHCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15234-NMCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15234-NYCHF230
Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF cloneHG15234-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG15234-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »