Commande rapide

Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain RGS5 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC030059
    Taille du ADNc:546bp
    Description du ADNc:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    Synonyme du gène:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    Espèces:Human
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone on other vectors
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15234-ACGCHF270
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15234-ACRCHF270
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15234-ANGCHF270
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15234-ANRCHF270
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15234-CFCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15234-CHCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15234-CMCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15234-CYCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 Gène ADNc clone le vecteur de clonageHG15234-GCHF90
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15234-NFCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15234-NHCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15234-NMCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15234-NYCHF230
    Humain RGS5 / Regulator of G-protein signaling 5 expression plasmide de Gène l'ADNc ORF cloneHG15234-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »