After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain RHEB/RHEB2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RHEB Informations sur les produits clonés de cDNA
Taille du ADNc:555bp
Description du ADNc:Full length Clone DNA of Homo sapiens Ras homolog enriched in brain with N terminal His tag.
Synonyme du gène:RHEB2, MGC111559, RHEB
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • Size / Price
    Catalogue : HG11382-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.