FAM82A2 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

FAM82A2 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Human family with sequence similarity 82, member A2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About FAM82A2

Entrez Gene ID

FAM82A2 cDNA ORF Clone, Human, N-His tag: Alternative Names

FAM82A2 cDNA ORF Clone, Human; FAM82C cDNA ORF Clone, Human; hucep-10 cDNA ORF Clone, Human; ptpip51 cDNA ORF Clone, Human; RMD-3 cDNA ORF Clone, Human; RMD3 cDNA ORF Clone, Human

FAM82A2 Background Information

Full Name
regulator of microtubule dynamics 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait