After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain RPE / RPE2-1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RPE Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC005148
Taille du ADNc:687bp
Description du ADNc:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase.
Synonyme du gène:HUSSY-17, MGC2636, RPE2-1, RPE
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

Références
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Catalogue : HG14238-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »