Commande rapide

Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RPGR Informations sur les produits clonés de cDNA
Taille du ADNc:2448bp
Description du ADNc:Full length Clone DNA of Homo sapiens retinitis pigmentosa GTPase regulator, transcript variant A with N terminal HA tag.
Synonyme du gène:CRD, RP3, COD1, PCDX, RP15, XLRP3, orf15, CORDX1
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10525-ACGCHF290
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10525-ACRCHF290
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10525-ANGCHF290
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10525-ANRCHF290
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10525-CFCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10525-CHCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10525-CMCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10525-CYCHF260
Humain RPGR transcript variant A Gène ADNc clone le vecteur de clonageHG10525-MCHF90
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10525-M-FCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10525-NFCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10525-NHCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10525-NMCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10525-NYCHF260
Humain RPGR transcript variant A expression plasmide de Gène l'ADNc ORF cloneHG10525-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10525-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.