After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain RSPO3 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human RSPO3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_032784.3
Taille du ADNc:819bp
Description du ADNc:Full length Clone DNA of Homo sapiens R-spondin 3 homolog (Xenopus laevis).
Synonyme du gène:PWTSR, THSD2, CRISTIN1, FLJ14440, RSPO3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-RSPO3
Site de restriction:KpnI + XbaI (6.1kb + 0.82kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutation 567 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.

Références
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • Size / Price
    Catalogue : HG11185-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »