RYBP cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

RYBP cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
726 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RING1 and YY1 binding protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.73kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RYBP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RYBP cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

RYBP cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

AAP1 cDNA ORF Clone, Human; DEDAF cDNA ORF Clone, Human; YEAF1 cDNA ORF Clone, Human

RYBP Background Information

APAP-1, also known as AAP1 and RYBP, is widely expressed. It is highest expressed in lymphoid tissues and placenta. APAP-1 contains 1 RanBP2-type zinc finger. It may bind to DNA. APAP-1 inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. It may be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. APAP-1 also promotes apoptosis.
Full Name
RING1 and YY1 binding protein
References
  • Li Mao, et al. (2009) RYBP stabilizes p53 by modulating MDM2. EMBO Rep. 10(2):166-72.
  • Schlisio, et al. (2002) Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. EMBO J. 21(21):5775-86.
  • Peter M E, et al. (2001) The death effector domain-associated factor plays distinct regulatory roles in the nucleus and cytoplasm. J Biol Chem. 276(34):31945-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait